Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
16 rows where measurement_class = "avidity_multivalent" and target_type = "protein" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, source_origin, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote
assay_method 6
- dot_blot 4
- ELISA 2
- MST 2
- PISA 2
- flow_cytometry 2
- saturation_binding 1
sequence_status 3
verification_level 1
tier 1
- Gold 16
target_type 1
- protein · 16 ✖
measurement_class 1
- avidity_multivalent · 16 ✖
binding_constant_type 1
- Kd 16
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 406 | SARS-CoV-2 spike protein (wild type) | protein | DSA1N5 | 3e-12 M | -11.523 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | undiluted wastewater | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). | step2c_acs_v1 | |||||||
| 743 | SARS-CoV-2 spike protein (wild type) | protein | DSA1N5 | 3.9e-12 M | -11.409 | avidity_multivalent | Kd | Gold | ACS | multi_agent_verified | pending_manual_supp | dot_blot | undiluted wastewater | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). | step2c_acs_v1 | |||||||
| 404 | SARS-CoV-2 pseudotyped lentivirus (omicron variant) | protein | DSA1N5 | 4.8e-12 M | -11.319 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | deionized water | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water) | step2c_acs_v1 | |||||||
| 405 | SARS-CoV-2 pseudotyped lentivirus (omicron variant) | protein | DSA1N5 | 5.1e-12 M | -11.292 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | wastewater (diluted 50% with binding buffer) | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater). | step2c_acs_v1 | |||||||
| 351 | thrombin | protein | P00734 | Supra-TBA15/29-GO | 1.9e-11 M | -10.721 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | DNA | Graphene Oxide immobilization; poly(adenine) anchor | 31157200 | 10.3389/fchem.2019.00280 | Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information). | step2c_acs_v1 | ||||||||
| 319 | VEGF165 | protein | P15692 | 3R02 Bivalent | TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC | 3e-11 M | -10.523 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 23237717 | 10.1021/ac303023d | The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR. | step2c_acs_v1 | ||||||||
| 312 | thrombin | protein | P00734 | MP-TBA15/TBA29-T15 | GGTTGGTGTGGTTGG | 5.2e-11 M | -10.284 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | saturation_binding | 7.4 | physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM) | DNA | thiolated; 15-mer thymidine linker | 22300379 | 10.1021/la204651t | MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3) | step2c_acs_v1 | |||
| 350 | alkaline phosphatase | protein | P09923 | ALP binding aptamer | CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC | 1.49e-09 M | -8.827 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | PISA | 9.5 | 50 mM glycine-NaOH buffer (pH 9.5) | DNA | 3'-thiol | 30827094 | 10.1021/acs.analchem.9b00465 | Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M | step2c_acs_v1 | |||
| 742 | alkaline phosphatase | protein | P09923 | ALP binding aptamer | CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC | 1.5000000000000002e-09 M | -8.824 | avidity_multivalent | Kd | Gold | ACS | multi_agent_verified | verified_in_text_or_SI | original | PISA | DNA | 3'-thiol | 30827094 | 10.1021/acs.analchem.9b00465 | giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM | step2c_acs_v1 | |||||
| 465 | SARS-CoV-2 spike RBD | protein | Aptx2-L | 4.900000000000001e-09 M | -8.31 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | flow_cytometry | 298.15 | 7.4 | PBS, pH 7.4, 0.55 mM MgCl2 | DNA | 41498844 | 10.1021/acsami.5c16490 | The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM | step2c_acs_v1 | ||||||
| 412 | Salmonella typhimurium | protein | Q8IWE5 | NTri-triApt | 1.1890000000000001e-08 M | -7.925 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | ELISA | 310.15 | 7.5 | PBS | DNA | biotin | 37893744 | 10.3390/foods12203853 | the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively | step2c_acs_v1 | ||||
| 336 | VEGF-165 | protein | P15692 | bivalent construct for VEGF-165 (no linker) | 1.7e-08 M | -7.77 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_figure | 27043498 | 10.3390/molecules21040421 | this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM) | step2c_acs_v1 | ||||||||||
| 466 | SARS-CoV-2 spike RBD | protein | Aptx2-S | 2.17e-08 M | -7.664 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | flow_cytometry | 298.15 | 7.4 | PBS, pH 7.4, 0.55 mM MgCl2 | DNA | 41498844 | 10.1021/acsami.5c16490 | compared to 21.7 nM for Aptx2-S | step2c_acs_v1 | ||||||
| 434 | Ara h1 | protein | P35354 | CB-APT1 | GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA | 3.63e-08 M | -7.44 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | 7.2 | 1 × binding buffer | DNA | 40083221 | 10.1021/acs.analchem.5c00270 | Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions. | step2c_acs_v1 | |||
| 413 | Salmonella typhimurium | protein | Q8IWE5 | NTri-biApt | 4.3090000000000004e-08 M | -7.366 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | ELISA | 310.15 | 7.5 | PBS | DNA | biotin | 37893744 | 10.3390/foods12203853 | the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively | step2c_acs_v1 | ||||
| 435 | Ara h1 | protein | P35354 | CB-APT1 | GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA | 4.5000000000000006e-08 M | -7.347 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | 7.2 | 1 × binding buffer with 80% w/w total peanut proteins | DNA | 40083221 | 10.1021/acs.analchem.5c00270 | Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5). | step2c_acs_v1 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';