kd_measurements: 46
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 46 | 24434496 | M55 | thrombospondin-1 | P07996 | 0.5 | μM | -6.301 | Kd | DNA | 5'-NH2; 5'-8-carbon PEG spacer; 3'-dT | ELISA | PBS | verified | step2c_literal_v3 | r00301 | ATACCAGCTTATTCAATTCCCAAATTGCCACCACTTACAGCATGATAACATACTACATCTTTTCATCAAGATAGTAAGTGCAATCT | 5'-ATA CCA GCT TAT TCA ATT CCC AAA TTG CCA CCA CTT ACA GCA TGA TAA CAT ACT ACA TCT TTT CAT CAA GAT AGT AAG TGC AAT CT-3' | intrinsic | The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 μ M | original | v4 | verified_in_text_or_SI | True | 10.1016/j.bios.2013.12.012 |